Order Entry
ContactUsLinkComponent
undefined | RT-PCR and cDNA Reagents
Catalog #: CA95040-334L
Supplier:  Cytiva
Catalog #: CA95040-334L
Supplier:  Cytiva
Price
1 368,48 $
Log in for availability
Unit of Measure Each
Restricted Products: To process your orders without delay, please provide the required business documentation to purchase this product.

To order chemicals, medical devices, or other restricted products please provide ID that includes your business name & shipping address via email [email protected] or fax 484.881.5997 referencing your VWR account number. Acceptable forms of ID are:

  • • State issued document with your organization's Federal Tax ID Number
  • • State issued document with your organization's Resale Tax ID Number
  • • City or County issued Business License
  • • State Department of Health Services License
  • • Any other ID issued by the State that includes the business name & address

* ATTN: California Customers may require additional documentation as part of the CA Health & Safety Code. Products that fall under this regulation will be placed on a mandatory 21-day hold after documentation is received. VWR will not lift restrictions for residential shipping addresses.

Specifications

  • Description:
    Ready-To-Go You-Prime First-Strand Beads
  • Cat. no.:
    CA95040-334L
  • No. of Reactions:
    50

Specifications

About this item

Ready-To-Go™ You-Prime First-Strand beads are preformulated, single-dose reaction beads prepackaged in thin-walled 0,5 ml tubes compatible with most thermal cyclers. Ready-To-Go™ You-Prime First-Strand beads are used for synthesis of first-strand cDNA templates from total RNA or polyadenylated RNA using a primer of choice.

  • Pre-dispensed, single-dose reaction beads minimise pipetting errors, avoid cross-contamination, and ensure optimal performance
  • First-strand reaction beads contain no primer, thus allowing users to select a first-strand primer of choice
  • Highly suitable for research applications that use PCR to detect and quantify eukaryotic RNA from a variety of samples
  • Reaction beads are function tested for first-strand synthesis of cDNA up to 7,5 kb and in RT-PCR from blood samples

Completed reactions (33µL final volume) can be used in PCR after adding water, Taq DNA polymerase, and primers; first-strand cDNA can also be used as a template for traditional Gubler-Hoffman second-strand cDNA synthesis.

Ordering: First-strand reaction mix (50 white tubes): Two beads containing reaction buffer, dATP, dCTP, dGTP,dTTP, Murine reverse transcriptase (FPLCpure), RNAguard™ (porcine), RNase/DNase-free BSA.
Control mix bead (5 red tubes): One ambient-temperature-stable bead containing rabbit globin mRNA (1 ng), buffer and 8 pmol each of 5’-specific globin primer (5’d[ACACTTCTGGTCCAGTCCGACTGAG]-3’) and 3’-specific globin primer (5’-d[GCCACTCACTCAGACTTTATTCAAA]-3’).
Customers Who Bought This Also Bought