To order chemicals, medical devices, or other restricted products please provide ID that includes your business name & shipping address via email [email protected] or fax 484.881.5997 referencing your VWR account number. Acceptable forms of ID are:
- • State issued document with your organization's Federal Tax ID Number
- • State issued document with your organization's Resale Tax ID Number
- • City or County issued Business License
- • State Department of Health Services License
- • Any other ID issued by the State that includes the business name & address
* ATTN: California Customers may require additional documentation as part of the CA Health & Safety Code. Products that fall under this regulation will be placed on a mandatory 21-day hold after documentation is received. VWR will not lift restrictions for residential shipping addresses.
Specifications
- Description:Ready-To-Go You-Prime First-Strand Beads
- Cat. no.:CA95040-334L
- No. of Reactions:50
Specifications
About this item
Ready-To-Go™ You-Prime First-Strand beads are preformulated, single-dose reaction beads prepackaged in thin-walled 0,5 ml tubes compatible with most thermal cyclers. Ready-To-Go™ You-Prime First-Strand beads are used for synthesis of first-strand cDNA templates from total RNA or polyadenylated RNA using a primer of choice.
- Pre-dispensed, single-dose reaction beads minimise pipetting errors, avoid cross-contamination, and ensure optimal performance
- First-strand reaction beads contain no primer, thus allowing users to select a first-strand primer of choice
- Highly suitable for research applications that use PCR to detect and quantify eukaryotic RNA from a variety of samples
- Reaction beads are function tested for first-strand synthesis of cDNA up to 7,5 kb and in RT-PCR from blood samples
Completed reactions (33µL final volume) can be used in PCR after adding water, Taq DNA polymerase, and primers; first-strand cDNA can also be used as a template for traditional Gubler-Hoffman second-strand cDNA synthesis.
Control mix bead (5 red tubes): One ambient-temperature-stable bead containing rabbit globin mRNA (1 ng), buffer and 8 pmol each of 5’-specific globin primer (5’d[ACACTTCTGGTCCAGTCCGACTGAG]-3’) and 3’-specific globin primer (5’-d[GCCACTCACTCAGACTTTATTCAAA]-3’).